View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12113_low_15 (Length: 229)
Name: NF12113_low_15
Description: NF12113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12113_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 21 - 215
Target Start/End: Original strand, 18588875 - 18589069
Alignment:
| Q |
21 |
gaagtttgatatgtcctattttcatttgtgaaggaatctaagtcaactgattgttcgaattttacatcaactttccttgatttaagccattttaatgtct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18588875 |
gaagtttgatatgtcctattttcatttgtgaaggaatctaagtcaactgattgttcgagttttacatcaactttccttgatttaagccattttaatgtct |
18588974 |
T |
|
| Q |
121 |
ttcttgaagcttttggtccaatatattctagcaatcttgatcctttatgcactattgtaacttttttgtcaggaaaatcaacagcaatctctgct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18588975 |
ttcttgaagcttttggtccaatatattctagcaatcttgatcctttatgcactattgtaacttttttgtcaggaaaatcaacagcaatctctgct |
18589069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University