View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12114_high_6 (Length: 308)
Name: NF12114_high_6
Description: NF12114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12114_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 15 - 204
Target Start/End: Original strand, 45214211 - 45214395
Alignment:
| Q |
15 |
ctgtggttgagagcgatatcaaaaatgactcctacctttggtcaagcatattgtcccttgtgaaaaaacaaatggtttatagaacaccaaatttcactat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
45214211 |
ctgtggttgagagcgatatcaaaaatgactcccacctttggtcaagcatattgtcccttgtgaaaaaacaaattgtttatagaacaccaaagttcactat |
45214310 |
T |
 |
| Q |
115 |
tgatcaacannnnnnnnnattgtcaccaacaaagattataatatatggtcaatatgactaaccaatgatgaacatttactctcacaacat |
204 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45214311 |
tgatcaacatttttttttattgtcaccaacaaagat-----tatatggtcaatatgactaaccaatgatcaacatttactctcacaacat |
45214395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University