View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12114_high_9 (Length: 215)
Name: NF12114_high_9
Description: NF12114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12114_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 4702957 - 4703134
Alignment:
| Q |
18 |
aaaaggactgggaagatatcaagtttggggtagacaatgaagttgacttctatgctgtatcatttgtcaaggatgctagagtggtttatgagttaaaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4702957 |
aaaaggactgggaagatatcaagtttggggtagacaatgaagttgacttctatgctgtttcatttgttaaggatgctagagtggtttatgagttaaaaga |
4703056 |
T |
 |
| Q |
118 |
atatctcaaaagtaattatgtttttgctatctaatttccattttatgcttgtttatcccattttgtgaatctggtatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
4703057 |
atatctcaaaagtaattatgtttttgctatctaatttccattttatgcttgtttatcccgttgtgtgaatctggtatg |
4703134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 20 - 93
Target Start/End: Original strand, 11594524 - 11594597
Alignment:
| Q |
20 |
aaggactgggaagatatcaagtttggggtagacaatgaagttgacttctatgctgtatcatttgtcaaggatgc |
93 |
Q |
| |
|
||||||||||| |||||||| ||||| || || || ||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
11594524 |
aaggactgggatgatatcaaatttggagtggataacaaagttgatttctatgctgtttcctttgttaaggatgc |
11594597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University