View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12115_high_2 (Length: 402)
Name: NF12115_high_2
Description: NF12115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12115_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 383
Target Start/End: Complemental strand, 45001895 - 45001512
Alignment:
| Q |
1 |
cagttccacatattgcaacaacaaacgatgatgaaatggttggtagaagaagaagcaaccgtttaatgaatacaaaacaaacaagtctgctgcctcactg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45001895 |
cagttccacatattgcaacagcaaacgatgatgaaatggttggtagaagaagaagcaaccgtttaatgaatacaaaacaaacaagtatgctgcctcactg |
45001796 |
T |
 |
| Q |
101 |
tcagatgaatatggcgacggtggccctgaaagcaccatttcatcaggaagaacgacccgtgcgggtgctttgaaacggtgagtggcgaagcaacaggtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45001795 |
tcagatgaatatggcgacggtggcccagaaagcaccatttcatcaggaagaacaacatgcgcgggtgctttgaaacggtgagtggcgaagcaacaggtgg |
45001696 |
T |
 |
| Q |
201 |
ccagc-cgagcgcaatgagaaggacgacaacggaggagggaggagaatccattgcggcaaagttacagcatgcgaatgcgggggaatgtataaatactga |
299 |
Q |
| |
|
||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45001695 |
ccatcgcgagcgcaatgagaaggacgacaatggaggagggaggagaatccattgcggcaaagttacagcatacgaatgcgggggaatgtataaatactga |
45001596 |
T |
 |
| Q |
300 |
caacatcgttgcaattcctcttcattgctaatttgggattctttagtggaagaagaaaagactctatcttcatttcattatttc |
383 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45001595 |
tagcatcgttgcaattcctcttcattgctaatttgggattctttagtggaagaagaaaagactctatcttcatttcattatttc |
45001512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University