View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12115_high_9 (Length: 201)
Name: NF12115_high_9
Description: NF12115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12115_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 9895684 - 9895514
Alignment:
| Q |
18 |
cctttgactattcttttatatgaatatacagtcttattgaaatagtgactgatatgtaaagtctaatcatgggtgtgtgatttgaatcacatttggcact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9895684 |
cctttgactattcttttatatgaatatacagtcttattgaaatagtgcctgatatgtaaagtctaatcatgggtgtgtgatttgaatcacatttggcact |
9895585 |
T |
 |
| Q |
118 |
aacatttttctattgttttctccttcgaatccggtgaagcacatttatgtttcatttcaatttttctgtgc |
188 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9895584 |
aacatttttctattgttttccccttcgaatcccgtgaagcacatttatgtttcattttaatttttctgtgc |
9895514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University