View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12116_high_1 (Length: 341)
Name: NF12116_high_1
Description: NF12116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12116_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 14 - 328
Target Start/End: Complemental strand, 43034962 - 43034648
Alignment:
| Q |
14 |
tggacatcatggggtcgtctcgaggcatggtgagagagaggtcctatcgatggcttgggctacaagatagagcttttctctgacaatggacctgttaatg |
113 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43034962 |
tggaaatcatggggtcatctcgaggcatggcgagagagaggtcctatcgatggcttgggctacaaggtagagcttttctctgacaatggacctgttaatg |
43034863 |
T |
 |
| Q |
114 |
caaaaccaattgctgaaggcacagtgagtgtgaaaaaaggtggtaaattctgcattgattctgcaatattgggttcaaagtggttaccgggtgaagggtt |
213 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43034862 |
caataccaattgctgaaggcacagtgagtgtgaaaaaaggtggtaaattctgcattgattctgcaatattgggttcaaagtggttaccgggtgaagggtt |
43034763 |
T |
 |
| Q |
214 |
tgtgatgggttcaactgtgagtggtgaaggaaaagtaagtaaacctgttgtacaagtgggggtacggcacgtgacttgcatgcctgatgctactctcttc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43034762 |
tgtgatgggttcaactgtgagtggtgaaggaaaagtaagtaaacctgttgtacaagtgggggtacggcacgtgacttgcatgcctgatgctgctctcttc |
43034663 |
T |
 |
| Q |
314 |
attgctctctctgct |
328 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43034662 |
attgctctctctgct |
43034648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University