View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12116_low_3 (Length: 294)
Name: NF12116_low_3
Description: NF12116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12116_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 16 - 286
Target Start/End: Complemental strand, 51805033 - 51804763
Alignment:
| Q |
16 |
gcttttccttcagaggaacaagatttcaggacaattaacaccaacaatctctagagcttataaccttgtcaaaattgatttcagttataactttctttct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51805033 |
gcttttccttcagaggaacaagatttcaggacaaataacaccaacaatctctagtgcttataaccttgtcaaaattgatttcagttataactttctttct |
51804934 |
T |
|
| Q |
116 |
ggtccaattccttctgagattggtaaccttagaaagcttaacttgcttatgctacaagcaaacaagctgaactcttctattcctgattcattctcttcct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804933 |
ggtccaattccttctgagattggtaaccttagaaagcttaacttgcttatgctacaagcaaacaagctgaactcttctattcctgattcattctcttcct |
51804834 |
T |
|
| Q |
216 |
tggaatcactcaaccttctagatctttccagtaatctcttaaccggaaacatccctgaaagcctctctgtg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804833 |
tggaatcactcaaccttctagatctttccagtaatctcttaaccggaaacatccctgaaagcctctctgtg |
51804763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 38 - 184
Target Start/End: Original strand, 20017733 - 20017879
Alignment:
| Q |
38 |
atttcaggacaattaacaccaacaatctctagagcttataaccttgtcaaaattgatttcagttataactttctttctggtccaattccttctgagattg |
137 |
Q |
| |
|
|||||| |||| |||| || ||||||||| ||||| || ||||||| ||||||||||||||||||| ||||| | ||||||||| ||||| | |||| |
|
|
| T |
20017733 |
atttcaagacatataactccgacaatctcttgagctattagccttgtcgaaattgatttcagttataaatttctctatggtccaatcccttcataaattg |
20017832 |
T |
|
| Q |
138 |
gtaaccttagaaagcttaacttgcttatgctacaagcaaacaagctg |
184 |
Q |
| |
|
||||||||||||| ||||| |||||| || |||||| ||||||||| |
|
|
| T |
20017833 |
gtaaccttagaaaacttaatttgcttgtgttacaagggaacaagctg |
20017879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 223 - 286
Target Start/End: Original strand, 20017900 - 20017963
Alignment:
| Q |
223 |
actcaaccttctagatctttccagtaatctcttaaccggaaacatccctgaaagcctctctgtg |
286 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| | |||||||| |||||||||||||| |
|
|
| T |
20017900 |
actcaaccttcttgatctttccaacaatctcttaactgagaacatccccaaaagcctctctgtg |
20017963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University