View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12117_high_7 (Length: 302)
Name: NF12117_high_7
Description: NF12117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12117_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 287
Target Start/End: Complemental strand, 24562653 - 24562385
Alignment:
| Q |
19 |
gctttacccttaggttggtcgaaggtcatgctatcaagtttgctgctcatcaggaagaaaacaacactgtcctccacacgaggcattttccactgcagtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562653 |
gctttacccttaggttggtcgaaggtcatgctatcaagtttgctgctcatcaggaagaaaacaacactgtcctccacacgaggcattttccactgcagtg |
24562554 |
T |
|
| Q |
119 |
tactcataggagatttgtgaagcccattgagaatgtgcatgggaattatgtgtatcaagttaatcagtatctaaagagttgcctagcaaagagcaacctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24562553 |
tactcataggagatttgtgaagcccattgagaatgtgcatgggaattacgtgtatcaagttaatcagtatctaaagagttgcccagcaaagagcaacctt |
24562454 |
T |
|
| Q |
219 |
gggtagttattaagacgtgtagggctgcgctttgtatggtcggtgtcatttcttatgtggtcctctctg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24562453 |
gggtagttattaagacgtgtagggctgcgctttgtatggtcggtgtcatttcttatgtggtcctttctg |
24562385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University