View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12117_low_13 (Length: 240)
Name: NF12117_low_13
Description: NF12117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12117_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 40959056 - 40959278
Alignment:
| Q |
1 |
ttgggttttttagccatgacccacatcatctatggcgttatccaaagttttcagatgaatactaggcagaattaaggttttaatggtgtggttcttgtgg |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40959056 |
ttggtttttttagccatgacccacatcatctatggtgttatccaaagttttcagatgaatactaggcagaattaaggttttaatggtgtggttcttgtgg |
40959155 |
T |
|
| Q |
101 |
ctttacagattgttctttagttagcttatttttatgaagacctaatttcacagtttggtggtttgcctataattttattttctgactttattttgcagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40959156 |
ctttacagattgttctttagttagcttatttttatgaagacctaatttcacagtttggtggtttgcctataattttattttctgactttattttgcagaa |
40959255 |
T |
|
| Q |
201 |
caatgcatttctgttacccaaac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40959256 |
caatgcatttctgttacccaaac |
40959278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 217
Target Start/End: Original strand, 40959457 - 40959496
Alignment:
| Q |
178 |
ttttctgactttattttgcagaacaatgcatttctgttac |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40959457 |
ttttctgaccttattttgcagaacaatgcatttctgttac |
40959496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 217
Target Start/End: Original strand, 40946532 - 40946571
Alignment:
| Q |
178 |
ttttctgactttattttgcagaacaatgcatttctgttac |
217 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
40946532 |
ttttctgacctcattttgcagaacaatgcatttctgttac |
40946571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University