View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12117_low_4 (Length: 434)
Name: NF12117_low_4
Description: NF12117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12117_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 1 - 419
Target Start/End: Complemental strand, 24562413 - 24561995
Alignment:
| Q |
1 |
cggtgtcatttcttatgtggtcctttctgtttttgcaattgtgtatggtcgttttgtaactgttgtacttgaatccattttctttgctactatgtgtctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562413 |
cggtgtcatttcttatgtggtcctttctgtttttgcaatcgtgtatggtcgttttgtaactgttgtacttgaatccattttctttgctactatgtgtctg |
24562314 |
T |
 |
| Q |
101 |
taaattttaatggacggcgtgtttgggtgcaattgtgtgcttatttgtttcatatgcttaagtgtggttgttttctaattgtgtgtggttgatgggttac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562313 |
taaattttaatggacggcgtgtttgggtgcaattgtgtgcttatttgtttcatatgcttaagtgtggttgttttctaattgtgtgtggttgatgggttac |
24562214 |
T |
 |
| Q |
201 |
taatagtgcggctgatgttgcgcattggattgactatggatatgagagatctatgttttattttatttgtattctcttttggctcgataatttatgatat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562213 |
taatagtgcggctgatgttgcgcattggattgactatggatatgagagatctatgttttattttatttgtattctcttttggctcgataatttatgatat |
24562114 |
T |
 |
| Q |
301 |
tatgctttactaacagaacatgactgtctcattagnnnnnnnnnagcttacagttttttgatttctcccatctttatgttttcatcagaaatcattgtat |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562113 |
tatgctttactaacagaacatgactgtctcattagtttttttttagcttacagttttttgatttctcccatctttatgttttcatcagaaatcattgtat |
24562014 |
T |
 |
| Q |
401 |
gaagtctgttttacgccac |
419 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24562013 |
gaagtctgttttacgccac |
24561995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University