View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12117_low_6 (Length: 334)
Name: NF12117_low_6
Description: NF12117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12117_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 130 - 318
Target Start/End: Complemental strand, 42002958 - 42002770
Alignment:
| Q |
130 |
tgattcaggttttaatgtttttctcccttttagttttaatggcactctttgtcttgactatggcaatatgaaagttgtattgtggaacccaactaccaag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42002958 |
tgattcaggttttaatgtttttctcccttttagttttaatggcactctttgtcttgactatggcaatatgaaagttgtattgtggaacccaactaccaag |
42002859 |
T |
|
| Q |
230 |
aaatttaagatcattcctccgtctagggatattgatcctaattggtatgtttgggctaataatcatcaagttggttatgaccatgttaa |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42002858 |
aaatttaagatcattcctccgtctagggatattgatcctaattggtatgtttgggctaataatcatcaagttggttatgaccatgttaa |
42002770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 14 - 132
Target Start/End: Complemental strand, 42003731 - 42003613
Alignment:
| Q |
14 |
agaggcggaggttgaggtgggggacgatccctggaagaatgacttgtaacagccatgatatgttttggaaagagcttttgactacagaagaatgcaaaca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003731 |
agaggcggaggttgaggtgggggacgatccctggaagaatgacttgtaacagccatgatatgttttggaaagagcttttgactacagaagaatgcaaaca |
42003632 |
T |
|
| Q |
114 |
tgcatggagatattagtga |
132 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42003631 |
tgcatggagatattagtga |
42003613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 42406202 - 42406259
Alignment:
| Q |
192 |
gcaatatgaaagttgtattgtggaacccaactaccaagaaatttaagatcattcctcc |
249 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
42406202 |
gcaatatgaaacttatattgtggaacccaactaccaatgaattcaaggtcattcctcc |
42406259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University