View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12117_low_7 (Length: 312)
Name: NF12117_low_7
Description: NF12117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12117_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 20 - 298
Target Start/End: Complemental strand, 47653233 - 47652956
Alignment:
| Q |
20 |
gtatgcttctatcacatagtggttaaccattttttattctcttggtgctannnnnnncccatgatgatatatcaataacttcaacttaggagatcatcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47653233 |
gtatgcttctatcacatagtggttaaccattttttattctcttggtgctatttttt-cccatgatgatatatcaataacttcaacttaggagatcatcaa |
47653135 |
T |
|
| Q |
120 |
atatcaaaataggcaaatgagtatgtaggcgtggcatattctttcgtatgatcacatttatccaatgctgacaatttcaatcaatatgccaattcaatcg |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47653134 |
atatcaaaataggcaaatgagtttgtaggcgtggcatattctttcgtatgatcacatttatccaatgctgacaatttcaatcaatatgccaattcaatcg |
47653035 |
T |
|
| Q |
220 |
taattaaacttatgattaaaaagattcttctttcattcattggaatacaaatgattattctcacgtggtattgggcaca |
298 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47653034 |
taattaaacttatgattaaaaaatttcttctttcattcattggaatacaaatgattattctcacgtggtattgggcaca |
47652956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University