View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12118_low_9 (Length: 240)
Name: NF12118_low_9
Description: NF12118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12118_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 19 - 87
Target Start/End: Original strand, 32612118 - 32612186
Alignment:
| Q |
19 |
ctaaattctttgtatcttcaaagaaattgctatttacatactttgtcctaattatgtagttcttgtttt |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32612118 |
ctaaatactttgtatcttcaaagcaattgctatttacatactttgtcctaattatgtagttcttgtttt |
32612186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 88 - 158
Target Start/End: Original strand, 32612214 - 32612284
Alignment:
| Q |
88 |
acttaaactctcagcagacttggtaagatgggagcaaatgtttgagataagctttgtttctttttcttcca |
158 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
32612214 |
acttaaaatctcagcagacttggtaagatgggagcaaatgattgagataagctttgcttctttttcttcca |
32612284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University