View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12118_low_9 (Length: 240)

Name: NF12118_low_9
Description: NF12118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12118_low_9
NF12118_low_9
[»] chr2 (2 HSPs)
chr2 (19-87)||(32612118-32612186)
chr2 (88-158)||(32612214-32612284)


Alignment Details
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 19 - 87
Target Start/End: Original strand, 32612118 - 32612186
Alignment:
19 ctaaattctttgtatcttcaaagaaattgctatttacatactttgtcctaattatgtagttcttgtttt 87  Q
    |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
32612118 ctaaatactttgtatcttcaaagcaattgctatttacatactttgtcctaattatgtagttcttgtttt 32612186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 88 - 158
Target Start/End: Original strand, 32612214 - 32612284
Alignment:
88 acttaaactctcagcagacttggtaagatgggagcaaatgtttgagataagctttgtttctttttcttcca 158  Q
    ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||    
32612214 acttaaaatctcagcagacttggtaagatgggagcaaatgattgagataagctttgcttctttttcttcca 32612284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University