View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12119_high_12 (Length: 316)
Name: NF12119_high_12
Description: NF12119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12119_high_12 |
 | |
|
| [»] scaffold0168 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0168 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 9 - 306
Target Start/End: Original strand, 22479 - 22781
Alignment:
| Q |
9 |
agcataggtagatgaatgaatgaaatttgaggttgtgcccaacaggaacaacaagaatagtctagcttatggtggatattgtgaatgctt-----aagga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
22479 |
agcataggtagatgaatgaatgaaatttgaggttgtgcccaaaaggaacaacaagaatagtctagcttgtggtggatattgtgaatgctttaaccaagga |
22578 |
T |
|
| Q |
104 |
gcaaggtaaagtgttggaagcatagggcatgtttcctatacacaatacctataccatagaggtcaatgaaatctcaaagcatgtctgggctgcctaactc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22579 |
gcaaggtaaagtgttggaagcatagggcatgtttcctatacacaatacctataccatagaggtcaatgaaatctcaaagcatgtctgggctgcttaactc |
22678 |
T |
|
| Q |
204 |
caactaggatcatttggacaaacttgtctaggatttgtttgtttatatgactattattaactgttcctcgttttgctaattagtctgcacttttttctgc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22679 |
caactaggatcatttggacaaacttgtctaggatttgtttgtttatatgactattattaactgttcctcgttttgctaattagtctgcacttttttctgc |
22778 |
T |
|
| Q |
304 |
aaa |
306 |
Q |
| |
|
||| |
|
|
| T |
22779 |
aaa |
22781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University