View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12119_low_2 (Length: 272)
Name: NF12119_low_2
Description: NF12119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12119_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 5e-68; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 19 - 177
Target Start/End: Complemental strand, 4871350 - 4871192
Alignment:
| Q |
19 |
gtaccaggaagtttaggtggctggttttggttcaattatttagggggtctattgatgtggtgttgatggcaactggtttgattttgtgttaggggaaagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
4871350 |
gtaccaggaagtttaggtggctggtttttgttcaattatttaaggggtctattgatgtggtgttgatggaaactggtttgattttgtgttaggggaaggt |
4871251 |
T |
 |
| Q |
119 |
ctgggtgttttttcttgatttggttaaggtttttctgctgtgattctattgtattaagg |
177 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4871250 |
ctgggtgtgtttgcttgatttggttaaggtttttctgctgtgattatattgtattaagg |
4871192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 19 - 96
Target Start/End: Complemental strand, 4845591 - 4845515
Alignment:
| Q |
19 |
gtaccaggaagtttaggtggctggttttggttcaattatttagggggtctattgatgtggtgttgatggcaactggtt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
4845591 |
gtaccaggaagtttaggtggctggtttttgttcaattattta-ggggtctattgatgtggtgttgatggaaactggtt |
4845515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 124 - 177
Target Start/End: Complemental strand, 4841636 - 4841583
Alignment:
| Q |
124 |
tgttttttcttgatttggttaaggtttttctgctgtgattctattgtattaagg |
177 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4841636 |
tgtttttgcttgatttggttaaggtttttctgctgtgattctattgtattaagg |
4841583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 132 - 177
Target Start/End: Complemental strand, 4834911 - 4834866
Alignment:
| Q |
132 |
cttgatttggttaaggtttttctgctgtgattctattgtattaagg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4834911 |
cttgatttggttaaggtttttctgctgtgattctattgtattaagg |
4834866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 177
Target Start/End: Complemental strand, 4860510 - 4860482
Alignment:
| Q |
149 |
ttttctgctgtgattctattgtattaagg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4860510 |
ttttctgctgtgattctattgtattaagg |
4860482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 177
Target Start/End: Complemental strand, 4880517 - 4880489
Alignment:
| Q |
149 |
ttttctgctgtgattctattgtattaagg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4880517 |
ttttctgctgtgattctattgtattaagg |
4880489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University