View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12120_low_3 (Length: 439)
Name: NF12120_low_3
Description: NF12120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12120_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 1e-88; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 16 - 185
Target Start/End: Complemental strand, 32959305 - 32959136
Alignment:
| Q |
16 |
tgaaaaaagcatacagcatcaaatgaactctgccagtagttagagatattgggttcacattctgttggttctttaaagacccacttgtgacacttatcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32959305 |
tgaaaaaagcatacagcatcaaatgaactctgccagtagttagagatattgggttcacattctgttggttctttaaagacccacttgtgacacttatcag |
32959206 |
T |
|
| Q |
116 |
atgcaactttccccattaacctgttccaaaacaaaatacacccaatcataacatagtacaaagaacaaga |
185 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32959205 |
atgcaactttccccatcaacctgttccaaaacaaaatacacccaatcataacatagtacaaagaacaaga |
32959136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 224 - 330
Target Start/End: Complemental strand, 32959097 - 32958995
Alignment:
| Q |
224 |
atacagttaagatttaaacagtaactcccttcacatgctattggagacaacaagaatcagatagatagatagaaagagaaggagagagaataaaagcaca |
323 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32959097 |
atacagttaagatttaaacagtaactctcttcacatgctattggagacaacaagaatcagataga----tagaaagagaaggagagagaataaaagcaca |
32959002 |
T |
|
| Q |
324 |
acatagt |
330 |
Q |
| |
|
||||||| |
|
|
| T |
32959001 |
acatagt |
32958995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 356 - 427
Target Start/End: Complemental strand, 32958961 - 32958890
Alignment:
| Q |
356 |
cctacccagtacccacccttctccataattatacagctgaatggacattttgctgaaagcttttctcacagg |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958961 |
cctacccagtacccacccttctccataattatacagctgaatggacattttgctgaaagcttttctcacagg |
32958890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University