View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12120_low_4 (Length: 417)
Name: NF12120_low_4
Description: NF12120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12120_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 9 - 399
Target Start/End: Original strand, 49034350 - 49034740
Alignment:
| Q |
9 |
gagaagcagagatcttatagtatttaactaaggagatatactagacatttatgcatgggaaagtctatattcgttaacctttcccaacctaatagtatca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49034350 |
gagaaggagagatcttatagtatttaactaaggagatatactagacatttatgcatgggaaagtctatattcgttaacctttcccaacctaatagtatca |
49034449 |
T |
 |
| Q |
109 |
tgattgcagtggattaacctaatgctagtgttcttatgataatgatatgataattattatagtaatgacgtgctccaagagtcaatggcttaacattgac |
208 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49034450 |
taattgcagtggattaacctaatgctagtgttcttatgataatgatatgataattattatagtaatgacgtgctccaagagtcaatggcttaacaatgac |
49034549 |
T |
 |
| Q |
209 |
tcaatgtgtcatttgattccacacgatcagattgcttttaatttggtattttcgattgcatgcaatggttgaaacctttttaatattgaactccttctgt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49034550 |
tcaatgtgtcatttgattccacacgatcagattgcttttaatttggtattttggattgcatgcaatggttgaaacctttttaatattgaactccttctgt |
49034649 |
T |
 |
| Q |
309 |
tggttaaatgtttaaatttagaactatcaaagtatttcttgatttaaatatagaaggaccgctacctcgtcactaatttaggtggtagatg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49034650 |
tggttaaatgtttaaatttagaactatcaaagtatttcttgatttaaatatagaaggaccactacctcgtcactaatttaggtggtagatg |
49034740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University