View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12121_high_10 (Length: 272)
Name: NF12121_high_10
Description: NF12121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12121_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 8 - 255
Target Start/End: Complemental strand, 40272623 - 40272376
Alignment:
| Q |
8 |
tcagcaattcaatcttactactgcaccactatatacattcgatatatgtgcgaaaaactagttatgtatagctaaactattgatccgcccctggttgggg |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40272623 |
tcagaaattcaatcttactactgcaccactatatacattcgatgtatgtgcgaaaaactagttatgtatagctaaactattgatccgcccctggttgggg |
40272524 |
T |
|
| Q |
108 |
tcaatttcgagttctcacaagagcttcaacatagaggccaaaatttgcggcgctacagaagctcctcaaacccgcaacacagtaggctttagcataaagc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40272523 |
tcaatttcgagttctcacaagagcttcaacatagaggccaaaatttgcggcgctacagaagctcctcaaacccgcaacacaataggctttagcataaagc |
40272424 |
T |
|
| Q |
208 |
ataggtgctgctgtgctatgacgtgacagcagcagcaactgactacat |
255 |
Q |
| |
|
|||||||| ||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
40272423 |
ataggtgccgctaagctatgacgcgacagcagcagcaactgactacat |
40272376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University