View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12121_high_14 (Length: 223)
Name: NF12121_high_14
Description: NF12121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12121_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 13867999 - 13867813
Alignment:
| Q |
17 |
tgcttggacgacttcagatcttgtgaataatttaagtttttgaaccctgggaatccaatcctacgatccttcatgaaaacgcggagacaatccggtatgg |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
13867999 |
tgcttcgacgacttcagatcttgtgaataatttaagtttttgaaccctgggaatccaatcctacgatccttcatgaaaacacggagacaatccggtgtgg |
13867900 |
T |
 |
| Q |
117 |
tagctgcatgagcgagctggaaaatgaggcagcgatgaccaacacagaactgcaatgtgtttatgtccggatcaatggtgaagccta |
203 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
13867899 |
tagctgcatgagcgagctggaaactgaggcagcgatgaccaacacagaactgcaacgtgtttatgtccggatcaatggcgaagccta |
13867813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 16 - 179
Target Start/End: Original strand, 11876288 - 11876451
Alignment:
| Q |
16 |
gtgcttggacgacttcagatcttgtgaataatttaagtttttgaaccctgggaatccaatcctacgatccttcatgaaaacgcggagacaatccggtatg |
115 |
Q |
| |
|
|||||| |||||| ||| |||||| ||||| || ||| ||||| ||||||||||||||| ||||||||||||||||| | || | | | |||||| |
|
|
| T |
11876288 |
gtgcttcgacgacctcaaatcttgcaaataagttttgttattgaaacctgggaatccaatcatacgatccttcatgaaatcacgaaaaatttgtggtatg |
11876387 |
T |
 |
| Q |
116 |
gtagctgcatgagcgagctggaaaatgaggcagcgatgaccaacacagaactgcaatgtgttta |
179 |
Q |
| |
|
||| |||| ||||||||||||||||||||||||| | | ||| |||||||||||||||||| |
|
|
| T |
11876388 |
gtatctgcgcgagcgagctggaaaatgaggcagcggtcagcaagggagaactgcaatgtgttta |
11876451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University