View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12121_high_16 (Length: 202)
Name: NF12121_high_16
Description: NF12121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12121_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 13 - 185
Target Start/End: Original strand, 27034671 - 27034841
Alignment:
| Q |
13 |
agcacagacacaggcattggcatcgaacacgacactgacacacgtcagacactagatacatcttctactatagagaaaatttatctttttgtaattgtca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27034671 |
agcacagacacaggcattggcatcgaacacgac--tgacacacgtcagacaccagatacatcttctactatagagaaaatttatctttttgtaattgtca |
27034768 |
T |
 |
| Q |
113 |
atctttcatatcttgtgtcataagtaatagtagtattttgaattaagaggttaggttcaaatgattaatgagt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27034769 |
atctttcatatcttgtgtcataagtaatagtagtattctgaattaagaggttaggttcaaatgattaatgagt |
27034841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University