View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12122_high_6 (Length: 265)
Name: NF12122_high_6
Description: NF12122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12122_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 248
Target Start/End: Original strand, 35835539 - 35835778
Alignment:
| Q |
9 |
agcacagacgaattccccagatacaaatcaatccaatataaattctgagccataatccaaaccgatcccatatgcattccattgcagtaggaaggcagtg |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35835539 |
agcacagtcgaattccccagatacaaatcaatccaatataaattctgagccataatccaaaccgatcccatatgcattccattgcagtaggaaggcagtg |
35835638 |
T |
|
| Q |
109 |
gtcgctttggtagaggcgcagatttgtatctctctttataagctagaagctatatgatatgtcaaatcattgtacaaaatttggcaaggtttaactgtaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35835639 |
gtcgctttggtagaggcgcagatttgtatctctctttataagctagaagctatatgatatgtcaaatcattgtacaaaatttggcaaggtttaactgtaa |
35835738 |
T |
|
| Q |
209 |
atagaaacccttaagccttttgagatgaaggtaactaatc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35835739 |
atagaaacccttaagccttttgagatgaaggtaactaatc |
35835778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University