View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12122_low_9 (Length: 251)
Name: NF12122_low_9
Description: NF12122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12122_low_9 |
 |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 16)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 161 - 230
Target Start/End: Original strand, 4622798 - 4622867
Alignment:
| Q |
161 |
ggtgattttggatcaaaaattgaccttaaatcacccctctttattgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4622798 |
ggtgattttggatcaaaaattgaccttaaatcacccctctttattgatgaagaagaagaaactagagttt |
4622867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 9 - 87
Target Start/End: Original strand, 4622644 - 4622724
Alignment:
| Q |
9 |
acctgtgcaaaacatgaaagacagacagcgccacaca--gacgacaaacacacccacgtcgcactaggacgacgaaatcac |
87 |
Q |
| |
|
||||| |||||||| |||||||| ||||||||||||| |||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
4622644 |
acctgagcaaaacaagaaagacaaacagcgccacacaaagacgacaaacactcccacgtcgcactaagacgacgaaatcac |
4622724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 4634311 - 4634246
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
4634311 |
gggtgattttgggtcaaaaattgaccttaaatcacccctctttgatggatgaaggagaagaaacta |
4634246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 9661881 - 9661816
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
9661881 |
gggtgattttgggtcaaaaattgaccctaaatcacccctctttgatggatgaaggagaagaaacta |
9661816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 1657656 - 1657721
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||| |||||| || ||||||| ||||||||||| |
|
|
| T |
1657656 |
gggtgattttgggtcaaaaattgaccctaaatcacctctctttgatggatgaaggagaagaaacta |
1657721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 16991900 - 16991835
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||| |||||| || ||||||| ||||||||||| |
|
|
| T |
16991900 |
gggtgattttgggtcaaaaattgaccctaaatcaccgctctttgatggatgaaggagaagaaacta |
16991835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 11817100 - 11817029
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||| |||||| || ||| |||| ||||||||||| || |||||||||||||||| |||||||| |
|
|
| T |
11817100 |
gggtgattttgggtcaaaacttaaccctaaaccacccctctttgatggatgaagaagaagaaattaaagttt |
11817029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 161 - 200
Target Start/End: Original strand, 44021652 - 44021691
Alignment:
| Q |
161 |
ggtgattttggatcaaaaattgaccttaaatcacccctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44021652 |
ggtgattttggatcaaaaattgaccttaaaccacccctct |
44021691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 46729004 - 46729047
Alignment:
| Q |
159 |
agggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
46729004 |
agggtgattttgggtcaaaaattgaccctaaatcacccctcttt |
46729047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 41486603 - 41486561
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
41486603 |
gggtgattttggatcaaaaattgaccctaaataacccctcttt |
41486561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 219
Target Start/End: Original strand, 14542601 - 14542658
Alignment:
| Q |
163 |
tgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaaga |
219 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| || ||||||| |||||| |
|
|
| T |
14542601 |
tgattttgggtcaaaaattgaccctaaatcacccctctttgatggatgaaggagaaga |
14542658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 28588589 - 28588524
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctct-ttattgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| ||| | || ||||||| ||||||||||| |
|
|
| T |
28588589 |
gggtgattttgggtcaaaaattgaccctaaatcacccttctatgatggatgaaggagaagaaacta |
28588524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 224
Target Start/End: Original strand, 54420800 - 54420863
Alignment:
| Q |
162 |
gtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||| ||||| | ||||||| ||||||||||| |
|
|
| T |
54420800 |
gtgattttgggtcaaaaattgaccctaaatcacccatctttggtggatgaaggagaagaaacta |
54420863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 3673651 - 3673609
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
||||||||| || ||||||||||||| |||||||||||||||| |
|
|
| T |
3673651 |
gggtgatttggggtcaaaaattgaccctaaatcacccctcttt |
3673609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 196
Target Start/End: Original strand, 4959664 - 4959697
Alignment:
| Q |
163 |
tgattttggatcaaaaattgaccttaaatcaccc |
196 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
4959664 |
tgattttggatcaaaaattgaccctaaatcaccc |
4959697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 199
Target Start/End: Complemental strand, 18935688 - 18935648
Alignment:
| Q |
159 |
agggtgattttggatcaaaaattgaccttaaatcacccctc |
199 |
Q |
| |
|
||||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
18935688 |
agggtgattctaggtcaaaaattgaccttaaatcacccctc |
18935648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 11)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 31645857 - 31645792
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
31645857 |
gggtgattttggatcaaaaattgaccctaaatcacccctctttaatggatgaaggagaagaaacta |
31645792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 34894002 - 34894067
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
34894002 |
gggtgattttgggtcaaaaattgaccgtaaatcacccctctttgatggatgaaggagaagaaacta |
34894067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 160 - 230
Target Start/End: Original strand, 6887264 - 6887335
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||| | ||||||||||| |||||||||||||||| || ||||||| ||||||||||| ||||| |
|
|
| T |
6887264 |
gggtgattttgggttaaaaattgaccctaaatcacccctctttgatggatgaaggagaagaaactagagttt |
6887335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 28618632 - 28618567
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
28618632 |
gggtgattttgggttaaaaattgaccttaaatcacccctctttggctgatgaaggagaagaaacta |
28618567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 201
Target Start/End: Original strand, 29310435 - 29310476
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctctt |
201 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29310435 |
gggtgattttggatcaaaaattgaccctaaatcacccctctt |
29310476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 33486656 - 33486699
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttta |
203 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
33486656 |
gggtgattttgggtcaaaaattgaccctaaatcacccctcttta |
33486699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 41554514 - 41554472
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
41554514 |
gggtgattttggatcaaaaattgatcctaaatcacccctcttt |
41554472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 230
Target Start/End: Complemental strand, 41988208 - 41988141
Alignment:
| Q |
164 |
gattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||||||| || | ||||| ||||||||||| ||||| |
|
|
| T |
41988208 |
gattttgaatcaaaaattgatcctaaatcacccctctttgataggtgaaggagaagaaactagagttt |
41988141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 19646127 - 19646169
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
19646127 |
gggtgattttgggtcaaacattgaccttaaaccacccctcttt |
19646169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 2415430 - 2415393
Alignment:
| Q |
158 |
aagggtgattttggatcaaaaattgaccttaaatcacc |
195 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
2415430 |
aagggtgattttgggtcaaaaattgaccctaaatcacc |
2415393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 202
Target Start/End: Complemental strand, 37425019 - 37424979
Alignment:
| Q |
162 |
gtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
37425019 |
gtgattttgggtcagaaattgaccataaatcacccctcttt |
37424979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 18)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 160 - 221
Target Start/End: Complemental strand, 40775295 - 40775233
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| || ||||||| |||||||| |
|
|
| T |
40775295 |
gggtgattttggatcaaaaattgaccctaaatcacccctctttgatggatgaaggagaagaaa |
40775233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 28015384 - 28015341
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttta |
203 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28015384 |
gggtgattttggatcaaaaattgaccctaaatcacccctcttta |
28015341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 162 - 229
Target Start/End: Original strand, 41748589 - 41748657
Alignment:
| Q |
162 |
gtgattttggatcaaaaattgaccttaaatcacccctctttattg-atgaagaagaagaaactaaagtt |
229 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||| || ||||||| |||||||||| |||| |
|
|
| T |
41748589 |
gtgattttggatcaaaaattgaccgtaaatcacatctctttagtgaatgaagatgaagaaactagagtt |
41748657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 24045318 - 24045360
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
24045318 |
gggtgattttgggtcaaaaattgaccttaaatcaccactcttt |
24045360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 47749762 - 47749720
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
47749762 |
gggtgattttgggtcaaaaattgaccataaatcacccctcttt |
47749720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 161 - 202
Target Start/End: Complemental strand, 16263414 - 16263373
Alignment:
| Q |
161 |
ggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
16263414 |
ggtgattttggatcaaaaattgatcctaaatcacccctcttt |
16263373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 24470423 - 24470358
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
24470423 |
gggtgattttgggtcaaaaattgcccctaaatcacccctctttggtggatgaaggagaagaaacta |
24470358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 24475371 - 24475306
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
24475371 |
gggtgattttgggtcaaaaattgcccctaaatcacccctctttggtggatgaaggagaagaaacta |
24475306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 196
Target Start/End: Complemental strand, 47156421 - 47156388
Alignment:
| Q |
163 |
tgattttggatcaaaaattgaccttaaatcaccc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47156421 |
tgattttggatcaaaaattgaccttaaatcaccc |
47156388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 162 - 202
Target Start/End: Original strand, 23732481 - 23732521
Alignment:
| Q |
162 |
gtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23732481 |
gtgattttgagtcaaaaattgaccttaaatcacccctcttt |
23732521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 199
Target Start/End: Original strand, 30992909 - 30992948
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctc |
199 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
30992909 |
gggtgattttgggtcaaaaattaaccttaaatcacccctc |
30992948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 221
Target Start/End: Original strand, 38649444 - 38649506
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttta-ttgatgaagaagaagaaa |
221 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||| |||| ||||||||| ||||||| |
|
|
| T |
38649444 |
gggtgattttgggtcaaaaattgactctaaatcacccctttttagttgatgaaggtgaagaaa |
38649506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 196
Target Start/End: Original strand, 25855309 - 25855342
Alignment:
| Q |
163 |
tgattttggatcaaaaattgaccttaaatcaccc |
196 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
25855309 |
tgattttggatcaaaaattgaccctaaatcaccc |
25855342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 224
Target Start/End: Complemental strand, 43483619 - 43483558
Alignment:
| Q |
163 |
tgattttggatcaaaaattgaccttaaatcacccctctttattgatgaagaagaagaaacta |
224 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| |||||| | |||||||| | |||||||| |
|
|
| T |
43483619 |
tgattttagatcaaaaattgaccctaaatcactcctcttagtggatgaagatgcagaaacta |
43483558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 49166955 - 49166890
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||| | ||||||||||||| |||||||||| ||||| | ||||||| ||||||||||| |
|
|
| T |
49166955 |
gggtgattttaggtcaaaaattgaccctaaatcacccatctttggtggatgaaggagaagaaacta |
49166890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 231
Target Start/End: Original strand, 14734136 - 14734208
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagtttc |
231 |
Q |
| |
|
||||||||| || ||||||||||||| |||| ||||| ||||| || |||||||||||| ||| || |||||| |
|
|
| T |
14734136 |
gggtgatttggggtcaaaaattgaccctaaaccacccttctttgatggatgaagaagaaaaaattagagtttc |
14734208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 230
Target Start/End: Original strand, 23177683 - 23177739
Alignment:
| Q |
175 |
aaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||||||||||| | ||||| || ||||||| ||||||||||| ||||| |
|
|
| T |
23177683 |
aaaaattgaccttaaatcactcatctttaatggatgaaggagaagaaactagagttt |
23177739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 202
Target Start/End: Original strand, 35141837 - 35141881
Alignment:
| Q |
158 |
aagggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||||||||| ||||| |
|
|
| T |
35141837 |
aagggtgatttttggtcaaaaattgaccctaaatcacccttcttt |
35141881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 26)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 160 - 221
Target Start/End: Complemental strand, 6089921 - 6089859
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaa |
221 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| || ||||||| |||||||| |
|
|
| T |
6089921 |
gggtgattttgggtcaaaaattgaccttaaatcacccctctttgatggatgaaggagaagaaa |
6089859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 3390460 - 3390395
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
3390460 |
gggtgattttgggtcaaaaattgaccctaaatcacccctctttgatggatgaaggagaagaaacta |
3390395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 25771473 - 25771408
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
25771473 |
gggtgattttgggtcaaaaattgaccctaaatcacccctctttgatggatgaaggagaagaaacta |
25771408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 161 - 230
Target Start/End: Complemental strand, 3464986 - 3464916
Alignment:
| Q |
161 |
ggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| | ||||||| |||||||| || ||||| |
|
|
| T |
3464986 |
ggtgattttggatcaaaaattgaccctaaatcacccctctttggtggatgaaggagaagaaattagagttt |
3464916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 230
Target Start/End: Original strand, 27024225 - 27024296
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||||||||| ||||| || ||||||| ||||||||||| ||||| |
|
|
| T |
27024225 |
gggtgattttgggtcaaaaaatgaccctaaatcacccatctttgatggatgaaggagaagaaactagagttt |
27024296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 40125417 - 40125346
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||| ||||||||| ||| |||||||||||||||| | ||||||| |||||||||||| |||| |
|
|
| T |
40125417 |
gggtgattttgggtcaaaaattaaccctaaatcacccctctttggtggatgaaggagaagaaactaaggttt |
40125346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 161 - 230
Target Start/End: Original strand, 25237413 - 25237483
Alignment:
| Q |
161 |
ggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| || ||||||| |||| |||||| ||||| |
|
|
| T |
25237413 |
ggtgattttggatcaaaagttgactctaaatcacccctctttaatagatgaaggagaataaactagagttt |
25237483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 173 - 230
Target Start/End: Original strand, 31263053 - 31263111
Alignment:
| Q |
173 |
tcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
||||| ||||||| |||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
31263053 |
tcaaagattgaccctaaatcacccctctttgatggatgaagaagaaaaaactaaagttt |
31263111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 37883681 - 37883639
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
37883681 |
gggtgattttggattaaaaattgaccctaaatcacccctcttt |
37883639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 10589066 - 10589001
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||| ||| | |||||||| |||||||||| |
|
|
| T |
10589066 |
gggtgattttgggtcaaaaattgaccctaaatcacccctttttggtggatgaagatgaagaaacta |
10589001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 15674062 - 15674103
Alignment:
| Q |
162 |
gtgattttggatcaaaaattgaccttaaatcacccctcttta |
203 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
15674062 |
gtgattttgggtcaaaaattgaccctaaatcacccctcttta |
15674103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 25516522 - 25516457
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||| ||||||| |||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
25516522 |
gggtgattttgggtcaaatattgaccctaaatcacccctctttggtggatgaaggagaagaaacta |
25516457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 41176890 - 41176825
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
41176890 |
gggtggttttgggtcaaaaattgaccctaaatcacccctctttggtggatgaaggagaagaaacta |
41176825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 44167795 - 44167860
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| || ||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
44167795 |
gggtgattttgggtcaaaaattgaccatatatcacccctctttggtggatgaaggagaagaaacta |
44167860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 199
Target Start/End: Original strand, 7640442 - 7640481
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctc |
199 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
7640442 |
gggtgattttgggtcaaaaattgaccctaaatcacccctc |
7640481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 16880045 - 16880088
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttta |
203 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16880045 |
gggtgattttgggtcaaaaattgaccaaaaatcacccctcttta |
16880088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 26491331 - 26491289
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
26491331 |
gggtgattttgggtcaaaaattgaacttaaattacccctcttt |
26491289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 224
Target Start/End: Complemental strand, 43566905 - 43566840
Alignment:
| Q |
159 |
agggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
||||||||||||| ||||||||||||| | |||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
43566905 |
agggtgattttgggtcaaaaattgaccct-aatcacccctctttggtggatgaaggagaagaaacta |
43566840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 3603013 - 3602948
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
||||||||||| |||||| |||||| |||||||||| ||||| || ||||||| ||||||||||| |
|
|
| T |
3603013 |
gggtgattttgagtcaaaagttgaccataaatcacccatctttgatggatgaaggagaagaaacta |
3602948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 196
Target Start/End: Original strand, 9715634 - 9715667
Alignment:
| Q |
163 |
tgattttggatcaaaaattgaccttaaatcaccc |
196 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
9715634 |
tgattttggatcaaaaattgaccctaaatcaccc |
9715667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 17037737 - 17037778
Alignment:
| Q |
162 |
gtgattttggatcaaaaattgaccttaaatcacccctcttta |
203 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
17037737 |
gtgattttgggtcaaaaattgaccaaaaatcacccctcttta |
17037778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 25623131 - 25623196
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
25623131 |
gggtgattttgggtcaaaaattgataataaatcacccctctttgatgtatgaagaaaaagaaacta |
25623196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 27191421 - 27191486
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
||||||||| || ||||||||||||| ||||||| |||||||| | ||||||| ||||||||||| |
|
|
| T |
27191421 |
gggtgatttagggtcaaaaattgaccctaaatcatccctctttggtggatgaaggagaagaaacta |
27191486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 27841235 - 27841300
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
||||||||| || ||||||||||||| ||||||| |||||||| | ||||||| ||||||||||| |
|
|
| T |
27841235 |
gggtgatttagggtcaaaaattgaccctaaatcatccctctttggtggatgaaggagaagaaacta |
27841300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 202
Target Start/End: Original strand, 42105839 - 42105880
Alignment:
| Q |
161 |
ggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
||||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
42105839 |
ggtgattttgggtcaaaaattgaccctaaagcacccctcttt |
42105880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 87
Target Start/End: Complemental strand, 41842118 - 41842047
Alignment:
| Q |
18 |
aaacatgaaagacagacagcgc--cacacagacgacaaacacacccacgtcgcactaggacgacgaaatcac |
87 |
Q |
| |
|
||||| |||||||| ||| ||| |||| ||||||| |||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
41842118 |
aaacaagaaagacaaacaacgcagcacaaagacgacgaacaaaccaacgtcgcactaagacgacgaaatcac |
41842047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 13)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 163 - 224
Target Start/End: Original strand, 27469821 - 27469883
Alignment:
| Q |
163 |
tgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
27469821 |
tgattttggttcgaaaattgaccttaaatcacccctctttaatggatgaagaagaagaaacta |
27469883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 22344998 - 22345063
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
22344998 |
gggtgattttgggtcaaaaattgaacctaaatcacccctctttgatggatgaaggagaagaaacta |
22345063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 52839453 - 52839408
Alignment:
| Q |
158 |
aagggtgattttggatcaaaaattgaccttaaatcacccctcttta |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
52839453 |
aagggtgattttgggtcaaaaattgaccctaaatcacccctcttta |
52839408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 162 - 224
Target Start/End: Original strand, 6212974 - 6213037
Alignment:
| Q |
162 |
gtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||| || || |||| ||||||||||| |
|
|
| T |
6212974 |
gtgattttgggtcaaaaattgaccataaatcacccctctttgatggacgaaggagaagaaacta |
6213037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 44514077 - 44514119
Alignment:
| Q |
161 |
ggtgattttggatcaaaaattgaccttaaatcacccctcttta |
203 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
44514077 |
ggtgattttgggtcaaaaattgaccctaaatcacccctcttta |
44514119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 231
Target Start/End: Original strand, 13691844 - 13691917
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatca-cccctcttta-ttgatgaagaagaagaaactaaagtttc |
231 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| || |||||||||| | |||||||||||||||| ||| ||||| |
|
|
| T |
13691844 |
gggtgattttgggtcaaaaattgaccctaaaccaccccctctttagtggatgaagaagaagaaattaaggtttc |
13691917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 30853869 - 30853934
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||| ||||||| | ||||||| ||||||||||| |
|
|
| T |
30853869 |
gggtgattttgggtcaaaaattgaccttgaatcacacctctttggtggatgaaggagaagaaacta |
30853934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 52839551 - 52839507
Alignment:
| Q |
158 |
aagggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
52839551 |
aagggtgattttgggtcaaaaattgatcataaatcacccctcttt |
52839507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 38646612 - 38646541
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| ||||||| || ||||||| |||| ||| || ||||| |
|
|
| T |
38646612 |
gggtgattttgggtcaaaaattgaccataaatcactcctctttgatagatgaaggagaaaaaattagagttt |
38646541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 230
Target Start/End: Original strand, 14717341 - 14717399
Alignment:
| Q |
173 |
tcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
||||||||||||| |||||||||||||||| | ||||||| ||||||||||| ||||| |
|
|
| T |
14717341 |
tcaaaaattgaccctaaatcacccctctttggtggatgaaggagaagaaactagagttt |
14717399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 201
Target Start/End: Complemental strand, 5832261 - 5832220
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctctt |
201 |
Q |
| |
|
||||||||| || ||||||||||||| ||||||||||||||| |
|
|
| T |
5832261 |
gggtgatttagggtcaaaaattgaccctaaatcacccctctt |
5832220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 33703595 - 33703660
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttta-ttgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| | ||||||||||| ||||||| ||||||||| | ||||||| |||| |||||| |
|
|
| T |
33703595 |
gggtgattttgggtaaaaaattgaccataaatcatccctctttagtggatgaaggagaaaaaacta |
33703660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 196
Target Start/End: Original strand, 44562835 - 44562871
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcaccc |
196 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
44562835 |
gggtgattttgggtcaaaaattgaccctaaatcaccc |
44562871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 13)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 1165482 - 1165547
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
1165482 |
gggtgattttgggtcaaaaattgaccctaaatcacccctctttgatggatgaaggagaagaaacta |
1165547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 20201144 - 20201209
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
20201144 |
gggtgattttgggtcaaaaattgaccctaaatcacccctctttggtggatgaaggagaagaaacta |
20201209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 20203326 - 20203391
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
20203326 |
gggtgattttgggtcaaaaattgaccctaaatcacccctctttggtggatgaaggagaagaaacta |
20203391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 22844079 - 22844037
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
22844079 |
gggtgattttgggtcaaaaattgaccttaaatcagccctcttt |
22844037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 160 - 221
Target Start/End: Complemental strand, 50460222 - 50460160
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaa |
221 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
50460222 |
gggtgattttatgtcaaaaattgaccttaaatcatccctctttgatggatgaagaagaagaaa |
50460160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 41882494 - 41882559
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||| ||||||| ||||||||||||| |||||||| ||||||| || ||||||| ||||||||||| |
|
|
| T |
41882494 |
gggtaattttgggtcaaaaattgaccctaaatcactcctctttgatggatgaaggagaagaaacta |
41882559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 42106139 - 42106074
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||| | ||||||||||||| |||||||||||||||| | |||||||| |||||||||| |
|
|
| T |
42106139 |
gggtgattttaggtcaaaaattgaccctaaatcacccctctttggtggatgaagatgaagaaacta |
42106074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 43029711 - 43029646
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||| ||| | |||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
43029711 |
gggtgattttgggtcaaaaaatgatcctaaatcacccctctttgatggatgaaggagaagaaacta |
43029646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 50519818 - 50519753
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| ||||| | ||||||| ||||||||||| |
|
|
| T |
50519818 |
gggtgattttgggtcaaaaattgaccctaaatcacccatctttggtggatgaaggagaagaaacta |
50519753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 230
Target Start/End: Original strand, 1220301 - 1220372
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||||||| || | ||||| |||||||| || ||||| |
|
|
| T |
1220301 |
gggtgattttgaatcaaaaattgatcctaaatcacccctctttgataggtgaaggagaagaaattagagttt |
1220372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 218
Target Start/End: Original strand, 1806546 - 1806605
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaag |
218 |
Q |
| |
|
||||||||| |||||||||||||||| |||| ||||||||||| | ||||||||||||| |
|
|
| T |
1806546 |
gggtgatttgggatcaaaaattgaccctaaaccacccctctttggtggatgaagaagaag |
1806605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 224
Target Start/End: Original strand, 43839602 - 43839667
Alignment:
| Q |
159 |
agggtgattttggatcaaaaattgaccttaaatcacccctctttattg-atgaagaagaagaaacta |
224 |
Q |
| |
|
||||||| ||||| ||||||||||||| |||||||||| |||||| || |||||| ||||||||||| |
|
|
| T |
43839602 |
agggtgactttgg-tcaaaaattgaccctaaatcacccatctttagtgaatgaaggagaagaaacta |
43839667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 22286835 - 22286900
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||| ||||| | ||||||||||||| |||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
22286835 |
gggtaattttaggtcaaaaattgaccctaaatcacccctctttggtggatgaaggagaagaaacta |
22286900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 12)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 31874112 - 31874047
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||| |||||| || ||||||| ||||||||||| |
|
|
| T |
31874112 |
gggtgattttgggtcaaaaattgaccctaaatcacctctctttgatggatgaaggagaagaaacta |
31874047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 161 - 224
Target Start/End: Complemental strand, 13864386 - 13864322
Alignment:
| Q |
161 |
ggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||| || |||||| ||||||||||| |
|
|
| T |
13864386 |
ggtgattttggctcaaaagttgaccttaaatcacccctctttgataaatgaaggagaagaaacta |
13864322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 9270049 - 9269978
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||||| | ||||||| ||||||||||| ||||| |
|
|
| T |
9270049 |
gggtgattttgggtcaaaaattgatcataaatcacccctctttggtggatgaaggagaagaaactagagttt |
9269978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 202
Target Start/End: Original strand, 16937428 - 16937467
Alignment:
| Q |
163 |
tgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16937428 |
tgattttggatcaaaaattgaccctaaatcacccctcttt |
16937467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 23766770 - 23766699
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||| | ||||||| ||||||||||| ||||| |
|
|
| T |
23766770 |
gggtgattttgggtcaaaaattgaccttaaatcacatctctttggtggatgaagtagaagaaactagagttt |
23766699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 10042789 - 10042747
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
10042789 |
gggtgattttgggtcaaaaattgaccataaatcacccctcttt |
10042747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 219
Target Start/End: Complemental strand, 44295341 - 44295284
Alignment:
| Q |
163 |
tgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaaga |
219 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| || ||||||| |||||| |
|
|
| T |
44295341 |
tgattttgggtcaaaaattgaccctaaatcacccctctttgatggatgaaggagaaga |
44295284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 221
Target Start/End: Complemental strand, 9992693 - 9992631
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctctttattg-atgaagaagaagaaa |
221 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| || || || |||||| |||||||| |
|
|
| T |
9992693 |
gggtgattttgggtcaaaaattgaccctaaatcacccccctctaatgaatgaaggagaagaaa |
9992631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 202
Target Start/End: Original strand, 27534489 - 27534527
Alignment:
| Q |
164 |
gattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
27534489 |
gatttgggatcaaaaattgaccctaaatcacccctcttt |
27534527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 37658994 - 37658952
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
37658994 |
gggtgattttgtgtcaaaaattgaccctaaatcacccctcttt |
37658952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 36545867 - 36545932
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||| |||||||| | ||||||| ||||||||||| |
|
|
| T |
36545867 |
gggtgatattgggtcacaaattgaccttaaatcatccctctttggtggatgaaggagaagaaacta |
36545932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 220
Target Start/End: Original strand, 39067816 - 39067860
Alignment:
| Q |
176 |
aaaattgaccttaaatcacccctctttattgatgaagaagaagaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||| | || |||||||||||| |
|
|
| T |
39067816 |
aaaattgaccttaaatcacccctcttaaaagaagaagaagaagaa |
39067860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 32457674 - 32457603
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttta-ttgatgaagaagaagaaactaaagttt |
230 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||| | ||||||| |||| ||||||| |||| |
|
|
| T |
32457674 |
gggtgattttgggtcaaaaattgacgctaaatcacccctctttagtagatgaaggagaaaaaactaaggttt |
32457603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 16913356 - 16913291
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
||||||||| || ||||||||||||| |||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
16913356 |
gggtgatttcgggtcaaaaattgaccctaaatcacccctctttggtggatgaaggagaagaaacta |
16913291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 199
Target Start/End: Complemental strand, 19759816 - 19759777
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctc |
199 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
19759816 |
gggtgattttgggtcaaaaattgaccctaaatcacccctc |
19759777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 224
Target Start/End: Complemental strand, 33194631 - 33194568
Alignment:
| Q |
162 |
gtgattttggatcaaaaattgaccttaaatcacccctctt-tattgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | || || ||||||||||||||||||| |
|
|
| T |
33194631 |
gtgattttggatcaaaaattgaccctaaatcaccaatattgaatggatgaagaagaagaaacta |
33194568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 12576564 - 12576606
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctcttt |
202 |
Q |
| |
|
||||||||| || ||||||||||||| |||||||||||||||| |
|
|
| T |
12576564 |
gggtgatttagggtcaaaaattgaccctaaatcacccctcttt |
12576606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 201
Target Start/End: Complemental strand, 32804322 - 32804281
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctctt |
201 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| |||| |
|
|
| T |
32804322 |
gggtgattttgggtcaaaaattgaccctaaatcacccatctt |
32804281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 223
Target Start/End: Complemental strand, 34020643 - 34020582
Alignment:
| Q |
163 |
tgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaact |
223 |
Q |
| |
|
|||| |||| ||||||||||||| |||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
34020643 |
tgatgttgggtcaaaaattgaccctaaaccacccctctttggtagatgaagaagaagaaact |
34020582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 200
Target Start/End: Original strand, 548951 - 548991
Alignment:
| Q |
160 |
gggtgattttggatcaaaaattgaccttaaatcacccctct |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
548951 |
gggtgattttgggtcaaaaattgaccttatatcactcctct |
548991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 224
Target Start/End: Original strand, 9736 - 9799
Alignment:
| Q |
162 |
gtgattttggatcaaaaattgaccttaaatcacccctcttt-attgatgaagaagaagaaacta |
224 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| |||||||| | ||||||| ||||||||||| |
|
|
| T |
9736 |
gtgattttgggtcaaaaattgaccctaaatcatccctctttggtggatgaaggagaagaaacta |
9799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University