View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12123_low_7 (Length: 217)
Name: NF12123_low_7
Description: NF12123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12123_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 120 - 211
Target Start/End: Complemental strand, 30866408 - 30866317
Alignment:
| Q |
120 |
gaattggagggtacaatacaataagctttattcactgtttttgttctgtttctcagtttgtaagcgttgttggaataattttttcacaggtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30866408 |
gaattggagggtacaatacaataagctttattcactgtttttattctgtttctcagtttgtaagcgttgttggaataattttttcataggtt |
30866317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 30866527 - 30866473
Alignment:
| Q |
1 |
tttttggagtctacaacacctttggttccagctctgtatttctctaaggttgatc |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30866527 |
tttttggagtctacaacacctttggttccagctcagtatttctctaaggttgatc |
30866473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University