View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_high_30 (Length: 345)
Name: NF12125_high_30
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 11601932 - 11601870
Alignment:
| Q |
19 |
gttctgggatacacaatgtagtataaagtgtcgtcaaatagtggctttagctgcgttatatca |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11601932 |
gttctgggatacacaatgtagtataaagtgttgtcaaatagtggctttagctgcgttatatca |
11601870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 85 - 114
Target Start/End: Original strand, 6382405 - 6382434
Alignment:
| Q |
85 |
tagtgtagcagaatttggacaaatcgctat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6382405 |
tagtgtagcagaatttggacaaatcgctat |
6382434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 117
Target Start/End: Original strand, 27720418 - 27720495
Alignment:
| Q |
40 |
tataaagtgtcgtcaaatagtggctttagctgcgttatatcactgtagtgtagcagaatttggacaaatcgctatttt |
117 |
Q |
| |
|
|||||||||||||||||| |||||| ||| | ||||| ||||||| ||||||||||||| ||||| | ||||||| |
|
|
| T |
27720418 |
tataaagtgtcgtcaaatggtggctacagcagtcttatagcactgtaaagtagcagaatttgaacaaaccactatttt |
27720495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 80 - 116
Target Start/End: Original strand, 18569501 - 18569537
Alignment:
| Q |
80 |
cactgtagtgtagcagaatttggacaaatcgctattt |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
18569501 |
cactgtagtgtagcagaatttgaacaaaccgctattt |
18569537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University