View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_high_34 (Length: 331)
Name: NF12125_high_34
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 68 - 321
Target Start/End: Original strand, 49910401 - 49910661
Alignment:
| Q |
68 |
ataatggttcttgtttaagagaaatcaatactaggttttactcgtaaatgattctcctctttgcccggattcctagtaatgcgtagaattgatttcagag |
167 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910401 |
ataatggttcttgtttaagagaaatcgatactaggttttactcgtaaatgattctcctctttgcccggattcctagtaatgcgtagaattgatttcagag |
49910500 |
T |
|
| Q |
168 |
caattggttcaagatgaaattgattatatttttatctcgtgttcac-------agatgggtcttgtcttcctcaactatgcatatttccctgtttactac |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910501 |
caattggttcaagatgaaattgattatatttttatctcgtgttcacagatgggagatgggtcttgtcttcctcaactatgcatatttccctgtttactac |
49910600 |
T |
|
| Q |
261 |
cggttctcattcacagttgtatatctttgactatgagtagtcttcatttaccacaggttct |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
49910601 |
cggttctcattcacagttgtatatctttgactatgagtagtcttcatttactaccggttct |
49910661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University