View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_high_37 (Length: 303)
Name: NF12125_high_37
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 20 - 287
Target Start/End: Complemental strand, 33496100 - 33495833
Alignment:
| Q |
20 |
tttgacaccagaatatggaaataacaacacccttatttgtattgatctactccaccctcatgattctgcccacgataattctctttggatgaatatctag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
33496100 |
tttgacaccagaatatggaaataacaacacccttatttgtattgatctactccaccctcatgattctgcccacaataattctctttggatgaatatctgg |
33496001 |
T |
 |
| Q |
120 |
aatcttgatattcctcaccgtgttcgagcctttatatggcatttagctcatcattgcttgcccgcccatgtcaatcttaatgcaagaggaattcagtgcg |
219 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
33496000 |
actctcgatattcctcaccgtgttcgagcctttatgtggcatttagctcatcatttcttgcccacccgtgtcaatcttaatgtaagaggaattcagtgcg |
33495901 |
T |
 |
| Q |
220 |
aggaatcatgcgttatgtgtgaaacttttgcggaatcccacattcatctcttctttgtttgtgcaaaa |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33495900 |
aggaatcatgcgttatgtgtgaaacttttgcggaatcccacattaatctcttctttgtttgtgcaaaa |
33495833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 54 - 287
Target Start/End: Original strand, 4243510 - 4243743
Alignment:
| Q |
54 |
atttgtattgatctactccaccctcatgattctgcccacgataattctctttggatgaatatctagaatcttgatattcctcaccgtgttcgagccttta |
153 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||| |||||||||||||||| ||||||||| |
|
|
| T |
4243510 |
atttgtagtgatctactccaccctcatgattctgcccacaataattcttcatggatgaatatctggaatctcaatattcctcaccgtgtccgagcctttc |
4243609 |
T |
 |
| Q |
154 |
tatggcatttagctcatcattgcttgcccgcccatgtcaatcttaatgcaagaggaattcagtgcgaggaatcatgcgttatgtgtgaaacttttgcgga |
253 |
Q |
| |
|
|||||| |||||||||| ||||||||||| | | |||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
4243610 |
tatggcgtttagctcataattgcttgcccactcgtgtcaatcttaatgcaagaggaatccagtgcgaggaatcatgtgttatgtttgaaaattttgcgga |
4243709 |
T |
 |
| Q |
254 |
atcccacattcatctcttctttgtttgtgcaaaa |
287 |
Q |
| |
|
|| ||||| |||||||||||||||||| |||||| |
|
|
| T |
4243710 |
atgccacactcatctcttctttgtttgcgcaaaa |
4243743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University