View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_high_43 (Length: 275)
Name: NF12125_high_43
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 11 - 261
Target Start/End: Complemental strand, 31304849 - 31304599
Alignment:
| Q |
11 |
aacctgtgttccttgcttctcaaggtgttgtcgaaaatttctattgcccacacgaggcccaccaaacgagatgactgtcaccattagtttaggaacacta |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31304849 |
aacctttgttccttgcttctcaaggtgttgtcgaaaatttctattgcccacacgaggcccaccaaacgagatgactgtcaccattagtttgggaacacta |
31304750 |
T |
 |
| Q |
111 |
atcttaacatcatacgcaatcaacgtagccaatgctgctcccaaactatgaccagttatggtcaaactcaattcttcttgactgtatatttgattgatcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31304749 |
atcttaacatcatacgcaatcaacgtagccaatgctgctcccaaactatgtccagttatggtcaaactcaattcttcttgacggtatatttgattgatcc |
31304650 |
T |
 |
| Q |
211 |
ttaaaatctcttgtttcaccattttttgcatactttctaacgatgattttg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31304649 |
ttaaaatctcttgtttcaccattttttgcatactttctaacgatgattttg |
31304599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University