View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_high_51 (Length: 242)
Name: NF12125_high_51
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_high_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 77 - 220
Target Start/End: Complemental strand, 6322458 - 6322315
Alignment:
| Q |
77 |
aattgtttatatacgagaccggaaagagtataatgctaaccctgagtagtttcagctgagtggtgcccatcagttgagcacatgttcatatgattattat |
176 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| | |
|
|
| T |
6322458 |
aattgtttatatatgagaccggaaagagtatattgctaaccctgagtagtttcagctgagtggtgcccgtcagttgagcacgtgttcatatgattattgt |
6322359 |
T |
|
| Q |
177 |
tgttatagtcagaggacagaaataaaccataatactgatcatct |
220 |
Q |
| |
|
| ||||||||| ||||| |||||||||||| ||||||||||||| |
|
|
| T |
6322358 |
tattatagtcaaaggacggaaataaaccatcatactgatcatct |
6322315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University