View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_14 (Length: 481)
Name: NF12125_low_14
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 2e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 225 - 435
Target Start/End: Complemental strand, 43428900 - 43428707
Alignment:
| Q |
225 |
attctcgacttaaatggtgggaattttatttgttcataaacaattttaaatgacaaattgtaggtgtctagttatctagctttcctttgttgatagcacc |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
43428900 |
attctcgacttaaatggtgggaattttatttgttcataaacaattttaaatgagaaattgtaggtgtctagttatctagc-----------------acc |
43428818 |
T |
|
| Q |
325 |
taactttaaaggtattttggtattgtttgtcttcactgcacatcttgaatctggtaattgttacctgtaatttgtccatgtcgttgcataaatggttatc |
424 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43428817 |
taactttaaaggtattgcggtattgtttgtcttcactgcacatctttaatctggtaattgttacctgtaatttgtccatgtcgttgcataaatggttatc |
43428718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 150 - 224
Target Start/End: Complemental strand, 43429007 - 43428933
Alignment:
| Q |
150 |
cttcgggaggggttttcttgtaggtctggtattaagggtttcccatgcccctgttagtgttgtcatgaatttagt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43429007 |
cttcgggaggggttttcttgtaggtctggtattaagggtttcccatgcccctgttagtgttgtcatgaatttagt |
43428933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University