View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_32 (Length: 335)
Name: NF12125_low_32
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_32 |
 | |
|
| [»] scaffold0066 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 7425341 - 7425666
Alignment:
| Q |
1 |
tttatgtattgtagcttctggtgttgacaacattgattggcattgcccaaccaaaatgatttcgcttgattcaggtggtttttcttttgtgttttgtatt |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7425341 |
tttatgtattgtagcttcttgtgttgacaacattgattggcattgcccaaccaaaatgattttgcttgattcaggtggtttttcttttgtgttttgtatt |
7425440 |
T |
|
| Q |
101 |
gcttgaacctgatgttgttggttcaggttctttcttggttatgccaactaggtgattggaggctcttgtattaaaattgtggcggacctttttaa-acct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7425441 |
gcttgaacctgatgttgttggttcaggttctttcttggttatgccaactaggtgattggaggctcttgtattaaaattgtggcggacctttttaacacct |
7425540 |
T |
|
| Q |
200 |
agctctttaagtcctagggcatgtctctgtaacatcacagattatttacgctgtgtctgaaatatccgaagtcgtggcagattgacaaattgttgattca |
299 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7425541 |
agctctttaagtcctagggcatttctctgtaacatcacagattatttatgctgtgtctgaaatatccgaagtcgtggcagattgacaaattgttgattca |
7425640 |
T |
|
| Q |
300 |
tagtctgaggtgggggtctgtctgtg |
325 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7425641 |
tagtctgaggtgggggtctgtctgtg |
7425666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 44 - 148
Target Start/End: Complemental strand, 11356927 - 11356823
Alignment:
| Q |
44 |
tgcccaaccaaaatgatttcgcttgattc-aggtggtttttcttttgtgttttgtattgcttgaacctgatgttgttggttcaggttctttcttggttat |
142 |
Q |
| |
|
||||| ||||||||||||| |||| ||| ||||||| ||||||| |||||||||||||||||||||| ||||||| ||||||| ||||| |||||||| |
|
|
| T |
11356927 |
tgccccaccaaaatgattttgctttattttaggtggtatttctttggtgttttgtattgcttgaacctagtgttgttagttcagggtcttt-ttggttat |
11356829 |
T |
|
| Q |
143 |
gccaac |
148 |
Q |
| |
|
| |||| |
|
|
| T |
11356828 |
gtcaac |
11356823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 251 - 322
Target Start/End: Complemental strand, 18139 - 18068
Alignment:
| Q |
251 |
tgtgtctgaaatatccgaagtcgtggcagattgacaaattgttgattcatagtctgaggtgggggtctgtct |
322 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||| || || |||||||||||||||||| |||||| ||||| |
|
|
| T |
18139 |
tgtgtctgaaatatccgaagttgcggcagtttggcagttttttgattcatagtctgaggagggggtgtgtct |
18068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University