View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_37 (Length: 322)
Name: NF12125_low_37
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 91 - 303
Target Start/End: Complemental strand, 5102609 - 5102397
Alignment:
| Q |
91 |
caattgaagaaggtagtgctgctaaggggaatgaagttgctgagaaaatcgaattgaaagatgaagagattgtggattccaaaacagttgatgaagttga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5102609 |
caattgaagaaggtagtgctgctaaggggaatgaagttgctgagaaaatcgaattgaaagatgaagaggttgtggattccaaaacagttgatgaagttga |
5102510 |
T |
|
| Q |
191 |
agagaaatttagggttttatctgtgaaatctgataatggaaaacagagttggaagttcagaaaaatgaaccatgctgtgaggaataatggtgttggagat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5102509 |
agagaaatttagggttttatctgtgaaatctgataatggaaaacagagttggaagttcagaaaaatgaaccatgctgtgaggaataatggtgttggagat |
5102410 |
T |
|
| Q |
291 |
ggtcatggacata |
303 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
5102409 |
ggtcgtggacata |
5102397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University