View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_40 (Length: 291)
Name: NF12125_low_40
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 9 - 276
Target Start/End: Complemental strand, 35208977 - 35208713
Alignment:
| Q |
9 |
agcataggaatgggagaaaggattcaagtatatggtaccaaccttggctagttggcttcgtatcttggcaacaactactcatcatttggagtgtccacat |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35208977 |
agcataggaacgggagaaaggattcaagtatatggtaccaaccttggctagttggcttcgtatctt---aacaactactcatcatttggagtgtccacat |
35208881 |
T |
|
| Q |
109 |
atcactgtttcatatttaatggtcacaacttaactcagaagcaatgaaatatagagctaattaatggactctttgaccataacacaacgatagggatatt |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
35208880 |
atcactgtttcagatttaatggtcacaacttaactcagaagcaatgaaatatggagctaattaatggactctttgaccataacacaaccataaggatatt |
35208781 |
T |
|
| Q |
209 |
taatactccatgacatgcctacttggaagattaataaagatggtggttatatggtcaggagtgtgtac |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35208780 |
taatactccatgacatgcctacttggaagattaataaagatggtggttatatggtcaggagtgtgtac |
35208713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 89 - 138
Target Start/End: Original strand, 32208398 - 32208447
Alignment:
| Q |
89 |
atcatttggagtgtccacatatcactgtttcatatttaatggtcacaact |
138 |
Q |
| |
|
||||||||||||| ||||||||||| ||| || | ||||||||||||||| |
|
|
| T |
32208398 |
atcatttggagtggccacatatcaccgttgcagacttaatggtcacaact |
32208447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University