View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_41 (Length: 289)
Name: NF12125_low_41
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 36 - 277
Target Start/End: Original strand, 47905102 - 47905342
Alignment:
| Q |
36 |
gggaaacaaattggatttttgtgtttcatgaagatgcaggaaggtaagaaaatggttcatgtgtttcataatgttatgtttggaacatacaaaacagagg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
47905102 |
gggaaacaaattggatttttgtgtttcatgaagatgcaggaaggtaagaaaatggttcatgtgtttcatgatgttatgtttggaacatggaaaacagagg |
47905201 |
T |
|
| Q |
136 |
caaggctgcaaaatcaggatgaagttgttggtatgatgaatgatataatgtcatggaaca--atgtcatattttttgtatgcatggtgtgcatgatgtct |
233 |
Q |
| |
|
| ||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47905202 |
cgaggttgcaaagtcaggatgaagttgttggtatgatgaatgatataaagtcatggaacaatatgtcatattttttgtatgcatggtgtgcatgatgtct |
47905301 |
T |
|
| Q |
234 |
atggttctttcactataacaaaacaaataattatgacacaggtt |
277 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47905302 |
atggttctttcactataacaaaaca---aattatgacacaggtt |
47905342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University