View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_46 (Length: 261)
Name: NF12125_low_46
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 45 - 242
Target Start/End: Complemental strand, 19173924 - 19173727
Alignment:
| Q |
45 |
tgttatataatgtttggactgctaaaaattgaacaggctagttatcccaaagttgggatctacaagagttcagaactgacagaaatgatataagtataac |
144 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19173924 |
tgttatataatgtttggactgccaaaaattgaacagactagttatcccaaagttgggatctacaagagttcagaactgacagaaatgatataagtataac |
19173825 |
T |
 |
| Q |
145 |
ctatgctctataggaatttcaccacttgagttgttgataggcaagtccaaggaaggaccatcataaagcttatttatgtgtgcatctcgtttcaacaa |
242 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19173824 |
ctatgctcaataggaatttcaccacttgagttgttgataggcaagtccaaggaaggaccatcataaagcttatttatgtgtgcatctcgtttcaacaa |
19173727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University