View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_47 (Length: 258)
Name: NF12125_low_47
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 29461791 - 29461670
Alignment:
| Q |
121 |
cagtctcagaaagaaagctcaaaagggaaatatccaattttggtacatttaattatacataatcctaattgaataaaagaatttgtgtaccaccatagtg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29461791 |
cagtctcagaaagaaagctcaaaagggaaatatccaattttggtacatttaattatacataatcctaattgaataaaagaatttgtgtaccaccatagtg |
29461692 |
T |
 |
| Q |
221 |
agaaaccatcaaaccaataaaa |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29461691 |
agaaaccatcaaaccaataaaa |
29461670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 29461911 - 29461866
Alignment:
| Q |
1 |
attaaaacaagggcccttaggttagtgtcaccagaattgagttgaa |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29461911 |
attaaaacaagggcccttaggttagtgtcaccagaattgagttgaa |
29461866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University