View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_48 (Length: 257)
Name: NF12125_low_48
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 4163786 - 4164009
Alignment:
| Q |
19 |
aagctgctcgaattctagaggagatgataatagatagatggctgcattccggatgagggaatgtggaatgtattaatgtgtggactttgggaccggaaaa |
118 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4163786 |
aagcagctcaaattctagaggagatgataatagatagatggctgcattccggatgagggaatgtggaatgtattaatgtgtggactttgggatcggaaaa |
4163885 |
T |
|
| Q |
119 |
aagttcgagaagctactgagctcttgctggctgagctgaagcagaaatttgttgaagttgagagttgaagtttgtgagttcagacgagggaatatgaact |
218 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4163886 |
aagtttgagaagctactgagctcttgttggctgagctgaagcagaaatttgttgaagttgagagttgaagtttgtgagttcagatgagggaatatgaact |
4163985 |
T |
|
| Q |
219 |
gtaccaatgtgtggactctctgtg |
242 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
4163986 |
gtaccaatgtgtggactttctgtg |
4164009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 4177027 - 4177206
Alignment:
| Q |
19 |
aagctgctcgaattctagaggagatgataatagatagatggctgcattccggatgagggaatgtggaatgtattaatgtgtggactttgggaccggaaaa |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4177027 |
aagctgctcgaattctggaggagatgata----ttagatggctgcattccggatgagggaatgtggaatgtattaatgtgtggactttgggatcggaaaa |
4177122 |
T |
|
| Q |
119 |
aagttcgagaagctactgagctcttgctggctgagctgaagcagaaatttgttgaagttgagagttgaagtttgtgagttcaga |
202 |
Q |
| |
|
||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
4177123 |
aagttcgagaaactactgagctattggtggctgagctgaagcagaaatttgttgaagctgagagttgaagtttgtaagtccaga |
4177206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University