View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_49 (Length: 257)
Name: NF12125_low_49
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 9857987 - 9858172
Alignment:
| Q |
17 |
agattttaatgttggtgttagaataccatgttcacacatgtttcatatgacttgtatctctgattggttggtgataggcaattcatgccctttgtgtagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9857987 |
agattttaatgttggtgttagaataccatgttcacacatgtttcatatgacttgtatctgtgattggttggtgataggcaattcatgccctttgtgtagg |
9858086 |
T |
 |
| Q |
117 |
tttcaattgcctacttgatttgtaatgttttattcattctggtttttcagaaaaaccacaaaaactacactgttttattaaggttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9858087 |
tttcaattgcctacttgatttgtaatgtttttttcattctggtttttcagaaaaaccacaaaaactacaacgttttattaaggttt |
9858172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 210 - 240
Target Start/End: Original strand, 9858161 - 9858191
Alignment:
| Q |
210 |
ttattaaggtttatactatgatgttgccata |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9858161 |
ttattaaggtttatactatgatgttgccata |
9858191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University