View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_51 (Length: 253)
Name: NF12125_low_51
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 96 - 236
Target Start/End: Complemental strand, 51215794 - 51215653
Alignment:
| Q |
96 |
cttcaacagccctaattatcaattaataatagcaatttggttcaattaaattcacaaagtactagttcag-tcgaaaaaagtacagttcgnnnnnnngta |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| | ||||||||||||||||| ||| |
|
|
| T |
51215794 |
cttcaacagccctaattatcaattaataatagcaatttggtacaattaaattcacaaagaactagttcagtttgaaaaaagtacagttcgtttttttgta |
51215695 |
T |
 |
| Q |
195 |
aaaatattttccgttcggtttgaaaccactgaatcggtgcac |
236 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51215694 |
aaaatattttccgtttggtttgaaaccactgaatcggtgcac |
51215653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University