View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12125_low_57 (Length: 230)
Name: NF12125_low_57
Description: NF12125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12125_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 214
Target Start/End: Complemental strand, 41210078 - 41209876
Alignment:
| Q |
12 |
agcagcagagattgaaagccctggcaagctttagtaaacatggttgatgatctatatcacaaggaaaacccattttaaaactattcagaggatgactaga |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41210078 |
agcagcagaaattgaaagccctggcaagctttagtaaacatggttgatgatctatatcacaaggaaaacccattttaaaactattcagaggatgaataga |
41209979 |
T |
|
| Q |
112 |
tgtagtttatctaagagcagcggacgaaaaacacataaatatagcccagtccaagtaaaatctgtaagcaattatcaagttggtatagataaacagaagt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41209978 |
tgtagtttatctaagagcagcggacgaaaaacacataaatatagcccagtccaagtaaaatctgtaagcaattatcaagttggtatagataaatagaagt |
41209879 |
T |
|
| Q |
212 |
atg |
214 |
Q |
| |
|
||| |
|
|
| T |
41209878 |
atg |
41209876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University