View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12126_low_2 (Length: 377)
Name: NF12126_low_2
Description: NF12126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12126_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 17 - 170
Target Start/End: Complemental strand, 38065154 - 38065001
Alignment:
| Q |
17 |
gtgacataataaaatgagcaaagtaacaccaaaaaatattcaacatagaaaaaccttctcaaagtgaacgggatcagtaggccacttaaacttccaccgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38065154 |
gtgacataataaaatgagcaaagtaacaccaaaaaatattcaacatagaaaaaccttctcaaagtgaacgggatcagtaggccacttaaacttccaccgt |
38065055 |
T |
 |
| Q |
117 |
acataatgagaacataaaaacttcacacattagtgggtataatttttccctcac |
170 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38065054 |
acataatgggaacataaaaacttcacacattagtgggtataatttttccctcac |
38065001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 261 - 363
Target Start/End: Complemental strand, 38064909 - 38064807
Alignment:
| Q |
261 |
gttgatatttgtcatttacgtgcatattacaatttacattagtaagtcttgtatgattataatctcaaataaaaaatatttggacacaatcacatgaaat |
360 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38064909 |
gttgatatttgtcatttacgtgcattttacaatttacattagtaagtcttttatgattataacctcaaatcaaaaatatttggacacaatcacatgaaat |
38064810 |
T |
 |
| Q |
361 |
aaa |
363 |
Q |
| |
|
||| |
|
|
| T |
38064809 |
aaa |
38064807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University