View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12127_low_8 (Length: 267)

Name: NF12127_low_8
Description: NF12127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12127_low_8
NF12127_low_8
[»] chr3 (1 HSPs)
chr3 (14-252)||(35271236-35271474)


Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 252
Target Start/End: Original strand, 35271236 - 35271474
Alignment:
14 atgatatccagttgtcggtgtacctcaaacactcaagttactagttagtataatggttaaggtaagtaagaggtttaaaatgagacataccttatgtaat 113  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||  ||| |||||||||||||||||||||||||| |||||    
35271236 atgatatccaattgtcggtgtacctcaaacactcaagttactagttagtataatgattaaggcgagtgagaggtttaaaatgagacataccttaggtaat 35271335  T
114 gttactcaaaaacaatattattgacaaattaacaaaggaaaatgtttcttaaaaattccaatgtgtatacacgtcttaagagagatagagataaaagaga 213  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||    
35271336 ggtactcaaaaacaatattattgacaaattaacaaaggaaaatgtttcttagaaatttcaatgtgtatacacgccttaagagagatagagataaaagaga 35271435  T
214 gtgatgtactagatgcaataaattaatgatgtgaaagaa 252  Q
    |||||||||||||||||||||||||||||||||| ||||    
35271436 gtgatgtactagatgcaataaattaatgatgtgatagaa 35271474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University