View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12128_high_7 (Length: 307)
Name: NF12128_high_7
Description: NF12128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12128_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 11 - 290
Target Start/End: Original strand, 54733162 - 54733441
Alignment:
| Q |
11 |
cagagatgggtttggaagtgaagggatataggaggtgtcaatcggaaattgagttggtgaggggtgtgaatagtgatgatgcgaaggatcaaagagtgtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733162 |
cagagatgggtttggaagtgaagggatataggaggtgtcaatcggaaattgagttggtgaggggtgtgaatagtgatgatgcgaaggatcaaagagtgtt |
54733261 |
T |
|
| Q |
111 |
gcaaaggtgtgagagtgataatgataagagtaagaggaaaaacattgaagttgataaagagaaaaaatggagtttatatcccgaagatggaatgagcagc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54733262 |
gcaaaggtgtgagagtgataatgataagagtaagaggaaaaacattgaagttgataaagagaaaaaatggagtttatatcctgaagatggaatgagcagc |
54733361 |
T |
|
| Q |
211 |
gacgaatttcgtcgcaccgtggaggcattcattgcaagacaacagaagctacgaataaatgaagtacaaaccatatttat |
290 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733362 |
gacgaatttcgtcgcacggtggaggcattcattgcaagacaacggaagctacgaataaatgaagtacaaaccatatttat |
54733441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University