View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12128_high_8 (Length: 249)
Name: NF12128_high_8
Description: NF12128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12128_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 6855994 - 6855775
Alignment:
| Q |
19 |
ctatgctccactcagctttaactttcttcatcacactataaagtcttcctatcacctctctctttctatcaactcaacttaatccaatcactttggaact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6855994 |
ctatgctccactcagctttaactttcttcatcacactataaagtcttcctatcacctctctctttctatcaactcaacttaatccaatcactttggaact |
6855895 |
T |
|
| Q |
119 |
cagttccatttcttcttcttaatattcaacaaacttaccaaacttgttttggtttccaataacatattatataatggcaacttctgtgacaattgttgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6855894 |
cagttccatttcttcttcttaatattcaacaaacttaccaaacttgttttggtttccaataacatattatataatggcaacttctgtgacaattgttgga |
6855795 |
T |
|
| Q |
219 |
gccattaacatggcacaggt |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6855794 |
gccattaacatggcacaggt |
6855775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University