View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12128_high_9 (Length: 229)
Name: NF12128_high_9
Description: NF12128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12128_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 29632135 - 29631940
Alignment:
| Q |
15 |
gagaactacataatgaagaatggtattttagttccacaaatgttgaagctctagaaaacattatagtagtgacctattcacctacatactacagctctat |
114 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29632135 |
gagaactgcataatgaagaatggtagtttagttccacaaatgttgaagctctagaaaacattatagtagtgacctattcacctacatgctacagctctat |
29632036 |
T |
 |
| Q |
115 |
ggggcagatatattgtgagaatcaaagggaagacagaaacaagacaagttagaatctttgagagtagtataatgagaatgttttcattggatggat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29632035 |
ggggcagatatattgtgagaatcaaagggaagacagaaacaagacaagttagaatctttgagagtagtataatgagaatgttttcattggatggat |
29631940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University