View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12129_high_8 (Length: 232)
Name: NF12129_high_8
Description: NF12129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12129_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 13590064 - 13589860
Alignment:
| Q |
18 |
tttacaagattaatctagtgattttttggggtatagtcattacggaactttctatgaggataaatagggcaagatatgaagaaaagcaaaaggtccaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
13590064 |
tttacaagattaatctagtgattttttggggtatagtcattacggaactttcgatgaggataaatagggcaaagtactaagaaaagcaaaaggtccaaca |
13589965 |
T |
|
| Q |
118 |
tgcgtagtgctatgagttgcatgtcgcgcatctaagaaggattcaaaagtggtcagctaccggtagatttttgatgtgtgcattaagttgtatgttgcac |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
13589964 |
tgcatagtgctatgagttgcatgtcgcgcatctaagaaggattcaaaagtggtcagctaccggtagatttgtgatgtgtgcagtaagttgtatgttgcac |
13589865 |
T |
|
| Q |
218 |
aggtt |
222 |
Q |
| |
|
||||| |
|
|
| T |
13589864 |
aggtt |
13589860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 177
Target Start/End: Original strand, 6724022 - 6724072
Alignment:
| Q |
127 |
ctatgagttgcatgtcgcgcatctaagaaggattcaaaagtggtcagctac |
177 |
Q |
| |
|
|||||||||||||||| | | |||||||| |||||||||||||||||||| |
|
|
| T |
6724022 |
ctatgagttgcatgtcatgtagctaagaagaattcaaaagtggtcagctac |
6724072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University