View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12129_high_9 (Length: 211)
Name: NF12129_high_9
Description: NF12129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12129_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 78 - 196
Target Start/End: Original strand, 30478867 - 30478986
Alignment:
| Q |
78 |
ttaaggatcattcatgtgtgctgatgataatgaactcaagttggttgagacttcatctgttgc-nnnnnnnccggacaactgttgcaccggactattcat |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30478867 |
ttaaggatcattcatgtgtgctgatgataatgaactcaagttggctgagacttcatctgttgctttttttttcggacaactgttgcaccggactattcat |
30478966 |
T |
 |
| Q |
177 |
tactcctcaagtcctctgtg |
196 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30478967 |
tactcctcaagtcctctgtg |
30478986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 78 - 196
Target Start/End: Complemental strand, 30681590 - 30681472
Alignment:
| Q |
78 |
ttaaggatcattcatgtgtgctgatgataatgaactcaagttggttgagacttcatctgttgcnnnnnnnccggacaactgttgcaccggactattcatt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || || ||||||||||||||||||||||| |
|
|
| T |
30681590 |
ttaaggatcattcatgtgtgctgatgataatgaactcaagtttgttgagacttcatctgttgcttttttt-cgcacgactgttgcaccggactattcatt |
30681492 |
T |
 |
| Q |
178 |
-actcctcaagtcctctgtg |
196 |
Q |
| |
|
||||||||| |||| |||| |
|
|
| T |
30681491 |
aactcctcaaatcctttgtg |
30681472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 79 - 196
Target Start/End: Original strand, 30745408 - 30745525
Alignment:
| Q |
79 |
taaggatcattcatgtgtgctgatgataatgaactcaagttggttgagacttcatctgttgcnnnnnnnccggacaactgttgcaccggactattcatt- |
177 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| || || ||||||||||||||||||||||| |
|
|
| T |
30745408 |
taaggatcattcatgtgtactgatgataatgaactcaagtttgttgagacttcatctgttgcttttttt-cgcacgactgttgcaccggactattcatta |
30745506 |
T |
 |
| Q |
178 |
actcctcaagtcctctgtg |
196 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
30745507 |
actcctcaagtcctttgtg |
30745525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 30478713 - 30478773
Alignment:
| Q |
19 |
attattgtcatgaattattcatagcaagttcatttactgaacagataagaaacaagaattt |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30478713 |
attattgtcatgaattattcatagcaagttcatttactgaacagataagaaacaagaattt |
30478773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 79 - 196
Target Start/End: Original strand, 30055636 - 30055753
Alignment:
| Q |
79 |
taaggatcattcatgtgtgctgatgataatgaactcaagttggttgagacttcatctgttgcnnnnnnnccggacaactgttgcaccggactattcatt- |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| || || ||||||||||||||||||||||| |
|
|
| T |
30055636 |
taaggatcattcatgtgtgctgatgataatgaactcaaatttgttgagacttcatctgttgcttttttt-cgcacgactgttgcaccggactattcatta |
30055734 |
T |
 |
| Q |
178 |
actcctcaagtcctctgtg |
196 |
Q |
| |
|
||| |||||||||| |||| |
|
|
| T |
30055735 |
acttctcaagtcctttgtg |
30055753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 79
Target Start/End: Complemental strand, 30681729 - 30681684
Alignment:
| Q |
34 |
tattcatagcaagttcatttactgaacagataagaaacaagaattt |
79 |
Q |
| |
|
|||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30681729 |
tatttataacaagttcacttactgaacagataagaaacaagaattt |
30681684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 79
Target Start/End: Complemental strand, 30717986 - 30717941
Alignment:
| Q |
34 |
tattcatagcaagttcatttactgaacagataagaaacaagaattt |
79 |
Q |
| |
|
|||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30717986 |
tatttataacaagttcacttactgaacagataagaaacaagaattt |
30717941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 79
Target Start/End: Original strand, 30745269 - 30745314
Alignment:
| Q |
34 |
tattcatagcaagttcatttactgaacagataagaaacaagaattt |
79 |
Q |
| |
|
|||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30745269 |
tatttataacaagttcacttactgaacagataagaaacaagaattt |
30745314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 79
Target Start/End: Original strand, 30055505 - 30055541
Alignment:
| Q |
43 |
caagttcatttactgaacagataagaaacaagaattt |
79 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30055505 |
caagttcacttactgaacagataagaaacaagaattt |
30055541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 78 - 107
Target Start/End: Complemental strand, 30717839 - 30717810
Alignment:
| Q |
78 |
ttaaggatcattcatgtgtgctgatgataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30717839 |
ttaaggatcattcatgtgtgctgatgataa |
30717810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 78 - 177
Target Start/End: Complemental strand, 20303603 - 20303508
Alignment:
| Q |
78 |
ttaaggatcattcatgtgtgctgatgataatgaactcaagttggttgagacttcatctgttgcnnnnnnnccggacaactgttgcaccggactattcatt |
177 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||| ||||| ||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
20303603 |
ttaaggatcattcatgtgtgatgatgat---gaactcaagttggttgagacatcatcagttgc-ttttttccgtgcaactgttgcaccggactattcatt |
20303508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University