View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12129_low_7 (Length: 274)
Name: NF12129_low_7
Description: NF12129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12129_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 38 - 198
Target Start/End: Original strand, 5511482 - 5511637
Alignment:
| Q |
38 |
atatattttctctaagattaaagcctaagttaagataaaattttatgagtaataattttcacattgcttattctatgtatggtcatgcgagtgttatgct |
137 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||| ||| |||||||||||||||||||||| |||| |||||| |
|
|
| T |
5511482 |
atatattttctctaacattaaagcctaag-----ataaaattttatcagtaataattttcatattacttattctatgtatggtcatgctagtgctatgct |
5511576 |
T |
 |
| Q |
138 |
caatgcagttgtggaactgtgatttgttgataacacggttagaggcacccaatgcacctcg |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5511577 |
caatgcagttgtggaacggtgatttgttgataacacggttagaggcacccaatgcacctcg |
5511637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University