View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12129_low_8 (Length: 263)
Name: NF12129_low_8
Description: NF12129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12129_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 33813207 - 33813438
Alignment:
| Q |
20 |
taattagttaatccttattcagctcaataaaggctgcccaaaatttcaaaatccaagaaggatcaactcgtagataactagcattggtaacataaaattc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33813207 |
taattagttaatccttattcagctcaataaaggctgcccaaaatttcaaaatccaagaaggatcaactcgtagataactagcattggtaacataaaattc |
33813306 |
T |
 |
| Q |
120 |
tcttgaacagtcactcacatttggtcgtcatggttttttgtgggctcaaatttagttgtcagaaattcctcacatacatagctacctctcaggccccaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33813307 |
tcttgaacagtcactcacatttggtcgtcatggttttttgtgggctcaaatttagttgtcagaaattcctcacatacatagctacctctcaggctccaat |
33813406 |
T |
 |
| Q |
220 |
aagacacttcaccccatattctcctcacacag |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33813407 |
aagacacttcaccccatattctcctcacacag |
33813438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University