View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12129_low_9 (Length: 239)
Name: NF12129_low_9
Description: NF12129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12129_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 51733564 - 51733342
Alignment:
| Q |
1 |
aagtcctacataaaaaacagtgtccagttttgcaataaaattctcaagacatgcctgaaacccatgcacaaagacaacaatcttcaacacgcgaacatta |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51733564 |
aagtcctacataaaaaacagtgtacagttttgcaataaaattctcaagacatgcctgaaacccatgcacaaagacaacaatcttcaacacacgaacatta |
51733465 |
T |
 |
| Q |
101 |
ctttttggtgcagatttcttcctgaaagtatgactccccagcccatttgttaagctatgtgaatccacaagtccaacatgtcctaggagtggaatttcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51733464 |
ctttttggtgcagatttcttcctgaaagtatgactccccagcccatttgttaagctatgtgaatccacaagtccaacatgtcctaggagtggaatttcac |
51733365 |
T |
 |
| Q |
201 |
tggtactacgccgtggtacattc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51733364 |
tggtactacgccgtggtacattc |
51733342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 52 - 116
Target Start/End: Complemental strand, 356341 - 356277
Alignment:
| Q |
52 |
tgcctgaaacccatgcacaaagacaacaatcttcaacacgcgaacattactttttggtgcagatt |
116 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||| |||| ||| ||||||| |
|
|
| T |
356341 |
tgcctgaaacccgtgcacaaagacaacaatcttcaacacgcgagcattgctttgtggggcagatt |
356277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University