View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12131_low_6 (Length: 245)
Name: NF12131_low_6
Description: NF12131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12131_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 22 - 230
Target Start/End: Complemental strand, 55594 - 55386
Alignment:
| Q |
22 |
attagaagaagaattgagtaaagcaaaggaatgagagggatgacgacgagaagcagaggctttgatggcctgagcagcaagggaattagtattgataatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55594 |
attagaagaagaattgagtaaagcaaaggaatgagagggatgacgacgagaagcagaggctttgatggcctgagcagcaagggaattagtattgataatt |
55495 |
T |
|
| Q |
122 |
ggaggagcgctatttggttcattatcatctaacaattcatgtcgcccattaatattaatatcttccttgaaggtcgaactccttgatacaacctgctttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55494 |
ggaggagcgctatttggttcattatcatctaacaattcatgtcgcccattaatattaatatcttccttgaaggtcgaactccttgatacaacctgctttc |
55395 |
T |
|
| Q |
222 |
tcctatatg |
230 |
Q |
| |
|
||||||||| |
|
|
| T |
55394 |
tcctatatg |
55386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 106
Target Start/End: Original strand, 27702163 - 27702225
Alignment:
| Q |
44 |
gcaaaggaatgagagggatgacgacgagaagcagaggctttgatggcctgagcagcaagggaa |
106 |
Q |
| |
|
||||||||| ||| ||| |||||||||| || ||||||||||||||| ||||| || |||||| |
|
|
| T |
27702163 |
gcaaaggaaagagcgggttgacgacgagcagtagaggctttgatggcttgagcggcgagggaa |
27702225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University